Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-196-5p URS00000D9842_9031

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Gallus gallus. Annotated by 3 databases (ENA, RefSeq, miRBase). Gallus gallus (chicken) gga-miR-196-5p sequence is a product of MIR196-4, MIR196B, gga-miR-196, miR-196-5p, miR-196, gga-miR-196-5p, MIR196A1, MIR196A2, MIR196-5 genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAGGUAGUUUCAUGUUGUUGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 12 other species

    1. Alligator mississippiensis ami-miR-196-5p
    2. Anolis carolinensis aca-miR-196a
    3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-196a
    4. Callorhinchus milii (elephant shark) eshark_mir-196_3
    5. Capra hircus (goat) chi-miR-196a
    6. Gorilla gorilla (western gorilla) ggo-miR-196
    7. Homo sapiens (human) microRNA miR-196
    8. Macaca mulatta mml-miR-196a-5p
    9. Mus musculus Mus_musculus piRNA piR-mmu-8195632
    10. Oryzias latipes (Japanese medaka) ola-miR-196a
    11. Pongo pygmaeus ppy-miR-196
    12. Xenopus tropicalis (tropical clawed frog) xtr-miR-196a
    Publications New