v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cricetulus griseus (Chinese hamster) cgr-miR-672 URS00000D812E_10029

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGGUUGGUGUACUGUGUGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Dasypus novemcinctus (nine-banded armadillo) dno-miR-672-5p
  2. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-672_5p (mature (guide))
  3. Equus caballus eca-miR-672
  4. Mus musculus mmu-miR-672-5p
  5. Oryctolagus cuniculus (rabbit) ocu-miR-672-5p
  6. Pteropus alecto pal-miR-672-5p
  7. Rattus norvegicus rno-miR-672-5p