Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-672-5p URS00000D812E_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-672: Mmu-mir-672 is a microRNA that has been shown to be unstable in fetal bovine serum (FBS) [PMC4547141]. In a study, peptide/RNA complexes and naked mmu-mir-672 were incubated in 10% FBS, and it was found that the steric hindrance within the peptide/siRNA complexes contributed to the RNase resistance of mmu-mir-672 [PMC4547141]. A control group was also included, consisting of a solution of naked mmu-mir-672 without peptide binding [PMC4547141]. Mmu-mir-672 was used in an RNase resistance assay to test the hypothesis that complex formation could protect siRNAs from RNase attack and enhance their stability [PMC4547141]. In another study, it was found that mmu-mir-672, along with other microRNAs such as mmu-miR-31 and mmu-miR-351, played important roles in the regulatory network with their degree being more than 5 [PMC3692539]. Mmu-mir-672 was also found to potentially inhibit Decr1 (2,4-dienoyl CoA reductase 1) expression [PMC3692539]. Additionally, it was observed that mmu-mir-672 expression was downregulated at short-term (ST) exposure to allergens but upregulated at long-term (LT) exposure. This effect could be reinforced by the downregulation of mmu-mir-672 targeting PHB2, a factor that restrains estrogen action and its activating pathway. On the other hand, topoisomerase II α (Top2a) mRNA expression showed an inverse correlation with mmu-mir-672 expression at ST and LT exposure to allergens [PMC3030602].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUUGGUGUACUGUGUGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Cricetulus griseus (Chinese hamster) cgr-miR-672
  2. Dasypus novemcinctus (nine-banded armadillo) dno-miR-672-5p
  3. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-672_5p (mature (guide))
  4. Equus caballus eca-miR-672
  5. Oryctolagus cuniculus (rabbit) ocu-miR-672-5p
  6. Pteropus alecto pal-miR-672-5p
  7. Rattus norvegicus rno-miR-672-5p
Publications