Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-2277-5p URS00000D6C3F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-2277: Hsa-mir-2277 is a species-specific miRNA in humans [PMC2833159]. It has been studied in the context of liver hepatocellular carcinoma (LIHC) and its association with tumor mutational burden (TMB) [PMC7355149]. In a study analyzing the prognosis of patients with hepatocellular carcinoma (HCC), hsa-mir-2277 was found to be significantly associated with patient outcomes [PMC7467934]. The miRNA signature associated with HCC prognosis included hsa-mir-2277 among other miRNAs [PMC7467934]. Methylation analysis revealed no methylation upstream of hsa-mir-2277 in the tested cells [PMC5190061]. Hsa-mir-2277, along with other miRNAs such as hsa-mir-1200, hsa-mir-145, hsa-mir-1250, hsa-mir-1273d, and hsa-mir-299, has been implicated in various diseases [PMC8797878]. These miRNAs were also found to be involved in the regulatory network associated with a specific circular RNA (hsa_circ_0065898) [PMC8797878]. References: [PMC2833159]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2833159/ [PMC7355149]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7355149/ [PMC7467934]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7467934/ [PMC5190061]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5190061/ [PM8797878]: https://www.ncbi.nlm.nih.gov/pmc/articles/PM8797878/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCGCGGGCUGAGCGCUGCCAGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications