Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR435 URS00000D5CA8_39947

• 20 nucleotides
• 1 database (ENA)
• Found in 1 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Automated summary: This miRNA sequence is 20 nucleotides long and is found in Oryza sativa Japonica Group. Annotated by 1 database (ENA). Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR435 sequence is a product of miR435, osa-miR435 genes. Found in the Oryza sativa Japonica Group reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location	Chromosome	Start	End	Strand	Ensembl	UCSC	Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
Go to location loading browser Can't view - strange chromosome name	{{ location.chromosome }}	{{ location.start | number }}	{{ location.end | number }}	{{ location.strand == "1" ? "forward" : "reverse" }}	{{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }}	UCSC	100%	{{ location.identity * 100 | number:0 }}%

No genome locations found for this sequence. Learn more →

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UUAUCCGGUAUUGGAGUUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

1. Oryza sativa (rice) osa-miR435

Download

• FASTA
• JSON