Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 70 (SNORA70) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 70 (SNORA70) URS00000D55EA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA70: SNORA70 is a type of small nucleolar RNA (snoRNA) that is found in mammalian genomes [PMC4124155]. It is part of a signature that includes other snoRNAs such as SNORA12, SNORA22, SNORA27, SNORA56, and SNORA64 [PMC8629011]. The gene expression levels of SNORA70 were found to be high in certain genes such as KLRB1, ZFP36L2, DUSP2, and ARL4C [PMC6506535]. Depletion of DKC1 mRNA in MDA-MB-231 cells resulted in a reduction of SNORA64 and SNORA67 along with SNORA70 [PMC7760958]. Additionally, univariate Cox analyses identified SNORD46, SNORD72, and other snoRNAs including SNORA70 as being significantly associated with survival outcomes [PMC9524901]. The duplication of the gene in monkey and mouse genomes was found to be mediated by transposable elements (TEs) [PMC2832892]. Furthermore, the importance of the SNORA70 gene was highlighted in relation to feed intake and metabolic adaptation to different thermal conditions [PMC9021797]. In summary, the snoRNA known as SNORA70 has been identified in mammalian genomes and has been associated with various genes and biological processes. It has been found to be involved in gene expression regulation and may have implications for survival outcomes. The duplication of the gene may be mediated by transposable elements. Additionally, it plays a role in metabolic adaptation to different thermal conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCGCAGCCAAUUAAGCCGACUGAGUUCCUUUCCUCAUGGGGACCCAGUGUGCGAUGGCUGCACACAGCAGCUUCCUUGGUAGUGUACGCAGCCUGUUGGUUGUAUGGGUUGCUCUAAGGGACCUUGGAGACAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications