Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) Dan-Mir-2-P8_3p* (star (passenger)) URS00000D51AF_9361

  • 22 nucleotides
  • 1 database (MirGeneDB)
  • Found in 16 other species
  • miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUCACAGGAUUAUACUGUGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Cochliomyia hominivorax mature cho-miR-308
  2. Cochliomyia macellaria mature cma-miR-308
  3. Drosophila ananassae dan-miR-308
  4. Drosophila erecta der-miR-308
  5. Drosophila grimshawi dgr-miR-308
  6. Drosophila melanogaster (fruit fly) dme-miR-308-3p
  7. Drosophila mojavensis dmo-miR-308
  8. Drosophila persimilis dpe-miR-308
  9. Drosophila pseudoobscura dps-miR-308
  10. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294441_df_nrg
  11. Drosophila sechellia dse-miR-308
  12. Drosophila simulans dsi-miR-308
  13. Drosophila virilis dvi-miR-308-3p
  14. Drosophila willistoni dwi-miR-308
  15. Drosophila yakuba dya-miR-308
  16. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-2679937