Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila pseudoobscura dps-miR-308 URS00000D51AF_7237

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUCACAGGAUUAUACUGUGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Cochliomyia hominivorax mature cho-miR-308
  2. Cochliomyia macellaria mature cma-miR-308
  3. Drosophila ananassae dan-miR-308
  4. Drosophila erecta der-miR-308
  5. Drosophila grimshawi dgr-miR-308
  6. Drosophila melanogaster (fruit fly) dme-miR-308-3p
  7. Drosophila mojavensis dmo-miR-308
  8. Drosophila persimilis dpe-miR-308
  9. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294441_df_nrg
  10. Drosophila sechellia dse-miR-308
  11. Drosophila simulans dsi-miR-308
  12. Drosophila virilis dvi-miR-308-3p
  13. Drosophila willistoni dwi-miR-308
  14. Drosophila yakuba dya-miR-308
  15. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-2679937