Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-308-3p URS00000D51AF_7227

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Drosophila melanogaster. Annotated by 5 databases (MirGeneDB, RefSeq, ENA, miRBase, FlyBase). Described in 13 papers. Drosophila melanogaster (fruit fly) dme-miR-308-3p sequence is a product of FBgn0262407, mir-308, 308-R, miR-308, miR-308-3p, dme-miR-308-3p, mir-308-RA, dme-miR-308, 308-RA genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAUCACAGGAUUAUACUGUGAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 15 other species

    1. Cochliomyia hominivorax mature cho-miR-308
    2. Cochliomyia macellaria mature cma-miR-308
    3. Dasypus novemcinctus Dan-Mir-2-P8_3p* (star (passenger))
    4. Drosophila ananassae dan-miR-308
    5. Drosophila erecta der-miR-308
    6. Drosophila grimshawi dgr-miR-308
    7. Drosophila mojavensis dmo-miR-308
    8. Drosophila persimilis dpe-miR-308
    9. Drosophila pseudoobscura dps-miR-308
    10. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294441_df_nrg
    11. Drosophila sechellia dse-miR-308
    12. Drosophila simulans dsi-miR-308
    13. Drosophila virilis dvi-miR-308-3p
    14. Drosophila willistoni dwi-miR-308
    15. Drosophila yakuba dya-miR-308
    16. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2679937