Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-548e-3p URS00000D2680_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-548e: Hsa-mir-548e is a member of the hsa-mir-548 family of microRNA genes, which has been found to have larger genetic distances with other members of the family [PMC3468316]. In HEK293 cells exposed to PbS-MPA QDs, the cellular levels of hsa-miR-532-3p and hsa-mir-548e were significantly decreased [PMC4560511]. Hsa-mir-548e is one of the five miRNAs proposed as exosomal biomarkers for exposure to PbS-MPA in HEK293 cells [PMC4560511]. It has also been identified as one of the miRNAs affected by rare CNVs in CAKUT and is part of a network of miRNA-gene interactions [PMC9587983]. Hsa-mir-548e has consistently been identified by four miRNA databases [PMC4359307]. Additionally, it is one of the 19 differential miRNAs found in LIHC patients with low and high TMB [PMC7355149].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAACUGAGACUACUUUUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications