Tribolium castaneum (red flour beetle) tca-miR-279b-3p URS00000D08A0_7070

• 22 nucleotides
• 3 databases (ENA, miRBase, RefSeq)
• Found in 34 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGACUAGAUCCACACUCAUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

1. Apis mellifera ame-miR-279d-3p
2. Blattella germanica Bge-Mir-279-o36_3p (mature (guide))
3. Centruroides sculpturatus (bark scorpion) Csc-Mir-279-P14b_3p (mature (guide))
4. Daphnia magna Dma-Mir-279-o6_3p (mature (guide))
5. Daphnia pulex dpu-miR-279a
6. Dinoponera quadriceps dqu-miR-279b-3p
7. Eisenia fetida Efe-Mir-279-o18_3p (mature (guide))
8. Heliconius melpomene hme-miR-279a
9. Ixodes ricinus (castor bean tick) iri-miR-279a-3p
10. Ixodes scapularis isc-miR-279
11. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-279-P10_3p (mature (guide))
12. Lottia gigantea (owl limpet) lgi-miR-279
13. Manduca sexta (tobacco hornworm) mse-miR-279a
14. Melibe leonina mle-miR-279-3p
15. Parasteatoda tepidariorum (common house spider) pte-miR-279-3p
16. Penaeus japonicus miR-279
17. Triops cancriformis tcf-miR-279a

Download

• FASTA
• JSON