Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Chiloscyllium plagiosum microRNA cpl-miR-27d-3p URS00000CCB2D_36176

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCACAGUGGCUAAGUUCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Bos taurus (cattle) bta-miR-27a-3p
  2. Canis lupus familiaris (dog) cfa-miR-27a
  3. Capra hircus (goat) chi-miR-27a-3p
  4. Gadus morhua gmo-miR-27d-3p
  5. Mus musculus Mus_musculus piRNA piR-mmu-8319572
  6. Oryzias latipes (Japanese medaka) ola-miR-27a
  7. Otolemur garnettii oga-miR-27a
  8. Ovis aries microRNA miR-27a
  9. Pteropus alecto pal-miR-27a-3p
  10. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62965
  11. Xenopus laevis xla-miR-27a-3p