Automated summary: This pre miRNA sequence is 84 nucleotides long and is found in Mus musculus. Annotated by 6 databases (miRBase, MGI, Rfam, ENA, RefSeq, Ensembl). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-25, RF02020). Mus musculus (house mouse) microRNA mmu-mir-25 precursor sequence is a product of ENSMUSG00000065394.3, mmu-mir-25 precursor, Mir25, mir-25 precurso, mir-25, 25, mir-25 precursor genes. Found in the Mus musculus reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GGCCAGUGUUGAGAGGCGGAGACUUGGGCAAUUGCUGGACGCUGCCCUGGGCAUUGCACUUGUCUCGGUCUGACAGUGCCGGCC
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.