Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-383-5p URS00000C5969_9031

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (ENA, RefSeq, miRBase, MirGeneDB). Gallus gallus (chicken) gga-miR-383-5p sequence is a product of miR-383-5p, gga-miR-383-5p, gga-miR-383, MIR383, miR-383 genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGAUCAGAAGGUGAUUGUGGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 29 other species

    1. Alligator mississippiensis Ami-Mir-383-v1_5p (mature (guide))
    2. Anolis carolinensis Aca-Mir-383-v1_5p (mature (guide))
    3. Bos taurus bta-miR-383
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-383a
    5. Canis lupus familiaris (dog) cfa-miR-383
    6. Cavia porcellus cpo-miR-383-5p
    7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-383-v1_5p (mature (guide))
    8. Chrysemys picta (Painted turtle) cpi-miR-383-5p
    9. Columba livia Cli-Mir-383-v1_5p (mature (guide))
    10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-383-5p
    11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-383-v1_5p (mature (guide))
    12. Equus caballus eca-miR-383
    13. Gekko japonicus Gja-Mir-383-v1_5p (mature (guide))
    14. Homo sapiens (human) hsa-miR-383-5p
    15. Macaca mulatta mml-miR-383
    16. Microcaecilia unicolor Mun-Mir-383_5p (mature (guide))
    17. Monodelphis domestica (gray short-tailed opossum) mdo-miR-383-5p
    18. Ophiophagus hannah (king cobra) oha-miR-383-5p
    19. Ornithorhynchus anatinus Oan-Mir-383-v1_5p (mature (guide))
    20. Oryctolagus cuniculus (rabbit) ocu-miR-383-5p
    21. Pan troglodytes (chimpanzee) ptr-miR-383
    22. Pongo pygmaeus ppy-miR-383
    23. Pteropus alecto pal-miR-383-5p
    24. Python bivittatus pbv-miR-383-5p
    25. Sarcophilus harrisii Sha-Mir-383-v1_5p (mature (guide))
    26. Sphenodon punctatus (tuatara) Spt-Mir-383_5p (mature (guide))
    27. Taeniopygia guttata tgu-miR-383-5p
    28. Xenopus laevis Xla-Mir-383-P1_5p (mature (guide))
    29. Xenopus tropicalis (tropical clawed frog) xtr-miR-383
    Publications New