Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 104 (SNORD104) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 104 (SNORD104) URS00000C304D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD104: SNORD104 is a small nucleolar RNA (snoRNA) that has been found to be downregulated in response to androgens, with a 5-fold decrease in expression [PMC8374107]. In addition, SNORD104 is upregulated in luminal breast cancer (BC) tumors that are estrogen receptor (ER) positive and progesterone receptor (PR) positive, compared to ER negative and PR negative tumors [PMC9803687]. Other small non-coding RNAs that show a negative response to androgens include miR-17-5p, miR-136-3p, miR-181c-5p, miR-625-3p, piR-31355, and the 5'-tRF LysCTT [PMC8374107]. These findings suggest that SNORD104 may play a role in the regulation of androgen signaling pathways and may be involved in the development of luminal BC tumors. Further research is needed to fully understand the functional significance of SNORD104 in these processes.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCUGCUGUGAUGACAUUCCAAUUAAAGCACGUGUUAGACUGCUGACGCGGGUGAUGCGAACUGGAGUCUGAGCCUGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications