Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nasonia vitripennis (jewel wasp) nvi-miR-210 URS00000C0433_7425

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGUGCGUGUGACAGCGGCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Apis mellifera ame-miR-210-3p
  2. Drosophila ananassae dan-miR-210
  3. Drosophila erecta der-miR-210
  4. Drosophila grimshawi dgr-miR-210
  5. Drosophila mojavensis dmo-miR-210
  6. Drosophila persimilis dpe-miR-210
  7. Drosophila pseudoobscura dps-miR-210a
  8. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294499_df_nrg
  9. Drosophila sechellia dse-miR-210
  10. Drosophila simulans dsi-miR-210
  11. Drosophila virilis dvi-miR-210-3p
  12. Drosophila willistoni dwi-miR-210
  13. Drosophila yakuba dya-miR-210
  14. Nasonia giraulti ngi-miR-210
  15. Tribolium castaneum (red flour beetle) tca-miR-210-3p
Publications