Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tribolium castaneum (red flour beetle) tca-miR-210-3p URS00000C0433_7070

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Tribolium castaneum. Annotated by 3 databases (miRBase, ENA, RefSeq). Described in 5 papers. Tribolium castaneum (red flour beetle) tca-miR-210-3p sequence is a product of tca-miR-210, miR-210, Mir210, tca-miR-210-3p, miR-210-3p genes. Found in the red flour beetle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUGUGCGUGUGACAGCGGCUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 14 other species

    1. Apis mellifera ame-miR-210-3p
    2. Drosophila ananassae dan-miR-210
    3. Drosophila erecta der-miR-210
    4. Drosophila grimshawi dgr-miR-210
    5. Drosophila mojavensis dmo-miR-210
    6. Drosophila persimilis dpe-miR-210
    7. Drosophila pseudoobscura dps-miR-210a
    8. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294499_df_nrg
    9. Drosophila sechellia dse-miR-210
    10. Drosophila simulans dsi-miR-210
    11. Drosophila virilis dvi-miR-210-3p
    12. Drosophila willistoni dwi-miR-210
    13. Drosophila yakuba dya-miR-210
    14. Nasonia giraulti ngi-miR-210
    15. Nasonia vitripennis nvi-miR-210