Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-706 URS00000BE267_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-706: Mmu-mir-706 is a type of microRNA that has been studied in various contexts. It has been found to closely match with Homo sapiens uncharacterized LOC105372576 [PMC6947010]. In experiments with MEL and MPRO cells, the 2'-O-methylated miRIDIAN mmu-mir-706 hairpin inhibitor was used to inhibit the activity of mmu-mir-706 [PMC4046156]. It is believed that Wfs1 and Dtl can regulate the expression of mmu-mir-706, along with other miRNAs [PMC7863986]. Mmu-mir-706 has been found to have a high degree of similarity with human hs-miR-6510-3p and is involved in alternative RNA splicing [PMC5387049]. In studies involving mice, the expression levels of mmu-miR-466 and mmu-mir-706 were significantly decreased [PMC3767082]. Mmu-mir-706 has also been found to be differentially expressed in various conditions, such as hepatic schistosomiasis and Star expression regulation [PMC9218868] [PMC3148237]. It targets mesodermal genes as well as Bcl2 modifying factor (Bmf) and vascular endothelial growth factor A (Vegfa) [PMC8509654]. The level of mmu-mir-706 was observed to be inversely related to that of its target gene Caspase-3 in mice infected with S. japonicum at 25 dpi [PMC4391475].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAGAAACCCUGUCUCAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications