v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Vitis vinifera (wine grape) vvi-miR156f URS00000BABFD_29760

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUGACAGAAGAUAGAGAGCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 66 other species

  1. Amborella trichopoda atr-miR156c
  2. Ananas comosus ath-miR157a
  3. Arabidopsis lyrata aly-miR157c-5p
  4. Arabidopsis thaliana ath-miR157a-5p
  5. Arachis hypogaea ahy-miR156b-5p
  6. Asparagus officinalis aof-miR156b
  7. Brassica napus (rape) bna-miR156c
  8. Brassica oleracea (wild cabbage) bol-miR157a
  9. Brassica rapa (field mustard) bra-miR157a
  10. Carica papaya cpa-miR156e
  11. Cucumis melo (muskmelon) cme-miR156b
  12. Cynara cardunculus cca-miR156c
  13. Fragaria vesca subsp. vesca fve-miR156g-5p
  14. Glycine max gma-miR156m
  15. Gossypium raimondii gra-miR157a
  16. Helianthus annuus han-miR156c
  17. Hypericum perforatum Hyp-miR156a
  18. Linum usitatissimum lus-miR156h
  19. Malus domestica mdm-miR156ab
  20. Manihot esculenta mes-miR156j
  21. Medicago truncatula (barrel medic) mtr-miR156e
  22. Nicotiana attenuata microRNA mir-157/156-like
  23. Pachycladon fastigiatum Pfa-miR157c
  24. Populus tomentosa Pto-miR156g
  25. Populus trichocarpa ptc-miR156h
  26. Prunus persica ppe-miR156i
  27. Ricinus communis (castor bean) rco-miR156h
  28. Rosa chinensis ath-miR157a-5p
  29. Solanum lycopersicum sly-miR156c
  30. Solanum tuberosum (potato) stu-miR156d-5p
  31. Theobroma cacao (cacao) tcc-miR156e
  32. Vigna unguiculata (cowpea) vun-miR156b
  33. Vriesea carinata vca-miR156b-5p
 Publications