Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-363-5p URS00000B989F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-363: Hsa-mir-363 is a microRNA that has been found to be associated with peripheral blasts, bone marrow blasts, and white blood cell count at diagnosis [PMC6114287]. It has also been shown to target S1PR1 [PMC9388337]. In the context of immune thrombocytopenia (ITP), hsa-mir-363, along with other microRNAs such as hsa-miR-30a and hsa-let-7b, plays a crucial role [PMC7345964]. In a study on lung cancer tissue samples, hsa-mir-363 was found to be consistently under-expressed [PMC10137184]. Additionally, hsa-mir-363 is one of the differentially expressed microRNAs (DEMs) that regulate target genes such as CCND3, RUNX2, CENPF, SIK2, KIAA1109, and NFAT5 [PMC8906974]. It has also been identified as one of the microRNAs that potentially modulate hub genes in lung cancer [PMC8155597]. References: [PMC6114287] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6114287/ [PMC9388337] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9388337/ [PMC7345964] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7345964/ [PMC10137184] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10137184/ [PMC8906974] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8906974/ [PM8155597] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM8155597/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGGUGGAUCACGAUGCAAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Capra hircus (goat) chi-miR-363-5p
  2. Ophiophagus hannah (king cobra) oha-miR-363-5p
  3. Ornithorhynchus anatinus oan-miR-363-5p
  4. Rattus norvegicus (Norway rat) rno-miR-363-5p
  5. Xenopus laevis xla-miR-363
  6. Xenopus tropicalis (tropical clawed frog) xtr-miR-363-5p
Publications