Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-2a-3p URS00000B85EA_7091

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Bombyx mori. Annotated by 3 databases (ENA, RefSeq, miRBase). Described in 6 papers. Bombyx mori (domestic silkworm) bmo-miR-2a-3p sequence is a product of miR-2a-3p, bmo-miR-2a, Mir2a-1, miR-2, Mir2a-2, miR-2a, bmo-miR-2a-3p genes. Found in the domestic silkworm reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAUCACAGCCAGCUUUGAUGAGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 196 other species

    1. Aedes aegypti (yellow fever mosquito) aae-miR-2c
    2. Anopheles gambiae (African malaria mosquito) aga-miR-2
    3. Apis mellifera (honey bee) ame-miR-2-3p
    4. Blattella germanica Bge-Mir-2-o68-v1_3p (mature (guide))
    5. Cochliomyia hominivorax mature cho-miR-2a-1-3p
    6. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-2a-1-3p
    7. Daphnia pulex (common water flea) dpu-miR-2
    8. Dinoponera quadriceps dqu-miR-2a-3p
    9. Drosophila ananassae dan-miR-2a
    10. Drosophila erecta der-miR-2a
    11. Drosophila grimshawi dgr-miR-2a
    12. Drosophila melanogaster dme-miR-2a-3p
    13. Drosophila mojavensis dmo-miR-2a
    14. Drosophila persimilis dpe-miR-2a
    15. Drosophila pseudoobscura dps-miR-2a
    16. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294483_df_nrg
    17. Drosophila sechellia dse-miR-2a
    18. Drosophila simulans dsi-miR-2a
    19. Drosophila virilis dvi-miR-2a-3p
    20. Drosophila willistoni dwi-miR-2a
    21. Drosophila yakuba dya-miR-2a
    22. Euprymna scolopes Esc-Mir-2-o20-v2_3p (mature (guide))
    23. Heliconius melpomene (postman butterfly) hme-miR-2b
    24. Helicoverpa armigera miR2a
    25. Hyalella azteca miR-2-1
    26. Ixodes ricinus (castor bean tick) iri-miR-2b-3p
    27. Ixodes scapularis (black-legged tick) isc-miR-2a
    28. Melibe leonina mle-miR-2b-3p
    29. Nasonia giraulti ngi-miR-2
    30. Nasonia longicornis nlo-miR-2
    31. Nasonia vitripennis nvi-miR-2c
    32. Octopus vulgaris Ovu-Mir-2-o23-v2_3p (mature (guide))
    33. Parasteatoda tepidariorum pte-miR-2d-3p
    34. Spodoptera frugiperda (fall armyworm) sfr-miR-2b-3p
    35. Tribolium castaneum tca-miR-2-3p
    Publications New