Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tursiops truncatus (common bottlenose dolphin) miR-223 URS00000B7E30_9739

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Tursiops truncatus. Annotated by 1 database (ENA). Described in 0 papers. Tursiops truncatus (common bottlenose dolphin) miR-223 sequence is a product of miR-223, 223 genes. Found in the common bottlenose dolphin reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGUCAGUUUGUCAAAUACCCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 62 other species

    1. Bos taurus bta-miR-223
    2. Callithrix jacchus cja-miR-223
    3. Capra hircus chi-miR-223-3p
    4. Chrysemys picta cpi-miR-223-3p
    5. Columba livia cli-miR-223-3p
    6. Equus caballus eca-miR-223
    7. Gadus morhua gmo-miR-223a-3p
    8. Homo sapiens (human) hsa-miR-223-3p
    9. Mus musculus (house mouse) mmu-miR-223-3p