Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-223-3p URS00000B7E30_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (IntAct, miRBase, LncBase, RefSeq, TarBase, PSICQUIC, ENA, MalaCards, GeneCards). Described in 71 papers. Homo sapiens (human) hsa-miR-223-3p sequence is a product of hsa-miR-223-3p, miR-223, miR-223-3p, MIR223, hsa-miR-223 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1R20, ABC35, ABCC7, AF6q21, AGO, AGO2, ALO17, AN, AN1, AN2.

Interactions 5

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-223-3p interacts with:

Interaction id Participant Synonyms
EBI-26441537 intact:EBI-20558404 EBI-20558404 ENST00000650285 mrna_igf1r
URS00000B7E30_9606-0 P10916 P10916
URS00000B7E30_9606-2 P10916 P10916
URS00000B7E30_9606-1 P62745 P62745
URS00000B7E30_9606-3 P62745 P62745

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUCAGUUUGUCAAAUACCCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Bos taurus (cattle) bta-miR-223
    2. Callithrix jacchus cja-miR-223
    3. Capra hircus chi-miR-223-3p
    4. Chrysemys picta (Painted turtle) cpi-miR-223-3p
    5. Columba livia (rock pigeon) cli-miR-223-3p
    6. Equus caballus (horse) eca-miR-223
    7. Gadus morhua gmo-miR-223a-3p
    8. Mus musculus (house mouse) mmu-miR-223-3p
    9. Tursiops truncatus miR-223