Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2595 (LINC02595) URS00000B571D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02595: LINC02595, a long non-coding RNA, has been found to be significantly upregulated in tumor tissues compared to adjacent normal tissues in colorectal cancer patients (Zhang et al., 2020) [PMC7496558]. This upregulation suggests a potential role for LINC02595 in colorectal cancer progression. Further investigation has revealed that LINC02595 can promote colorectal cancer progression by inhibiting the activity of miR-203b-3p (Zhang et al., 2020) [PMC8164820]. This interaction between LINC02595 and miR-203b-3p suggests a regulatory mechanism by which LINC02595 contributes to the development and progression of colorectal cancer. The inhibition of miR-203b-3p activity by LINC02595 may lead to dysregulation of downstream target genes, which could promote tumor growth and metastasis. Understanding the role of LINC02595 in colorectal cancer may provide insights into potential therapeutic targets for this disease. Further studies are needed to elucidate the precise mechanisms by which LINC02595 regulates miR-203b-3p activity and its downstream effects on tumor progression.

Targeting miRNAs 1 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGAAAUGAGGACCACCGCUCCGGGGCGCGAGUAGGCGCGUGGAGUCCGGGGGCUCAGCCGCCGCGCCUCUUCCUCCUGCAGCUGGAGACUGCAACAGCGGCGGGUGCACCGGCAGCAGCGACGACCCUGCGCGCAGGUGGCAGUGUAGAAGCCAGACCGGGAGCUUCCAGAAGUGGUUUCUGAAAGAGUCAAAUGUACAUGAGUAAGCAAGCACAGGAAUCUGAAAAACCACAGGCCCACUAAUUUGCCUGCUUGACUAAAAUAAGGACGAGUUAUGUGCUGAUGAGAGACAUGUUUGUAAUGUUAUUCGUUGUGACACAGUUCAAAAGAAUUUGCCUUUGAUUCUCACUAAAAUGUAAAGUUUUGCAUAUUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications