Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Oryctolagus cuniculus let-7 microRNA precursor secondary structure diagram

Oryctolagus cuniculus let-7 microRNA precursor URS00000B0351_9986

Automated summary: This pre miRNA sequence is 88 nucleotides long and is found in Oryctolagus cuniculus. Annotated by 1 database (Rfam). Described in 3 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (let-7, RF00027). Oryctolagus cuniculus let-7 microRNA precursor sequence is a product of 7 microRNA precursor, let-7 microRNA precursor, 7 microRNA precurso genes. Found in the rabbit reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCAGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUAACUGUACAGGCCACUGCCUUGCCAGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 43 other species

    1. Ailuropoda melanoleuca let-7 microRNA precursor
    2. Callithrix jacchus let-7 microRNA precursor
    3. Camelus ferus let-7 microRNA precursor
    4. Canis lupus familiaris let-7 microRNA precursor
    5. Cricetulus griseus (Chinese hamster) miRNA (Mirlet7g)
    6. Dasypus novemcinctus (nine-banded armadillo) miRNA
    7. Equus caballus let-7g stem-loop (eca-let-7g)
    8. Erinaceus europaeus (western European hedgehog) miRNA
    9. Felis catus let-7 microRNA precursor
    10. Fukomys damarensis (Damara mole rat) miRNA
    11. Gorilla gorilla gorilla let-7 microRNA precursor
    12. Heterocephalus glaber miRNA
    13. Homo sapiens let-7 microRNA precursor
    14. Jaculus jaculus miRNA
    15. Loxodonta africana microRNA let-7g
    16. Macaca fascicularis let-7 microRNA precursor
    17. Macaca mulatta let-7 microRNA precursor
    18. Mesocricetus auratus (Golden Hamster) miRNA
    19. Microtus ochrogaster microRNA let7g
    20. Monodelphis domestica let-7 microRNA precursor
    21. Mus caroli microRNA let7g
    22. Mus musculus let-7g stem-loop (mmu-let-7g)
    23. Mus pahari microRNA let7g
    24. Mus spretus microRNA let7g
    25. Mustela putorius furo let-7 microRNA precursor
    26. Myotis brandtii let-7 microRNA precursor
    27. Myotis davidii let-7 microRNA precursor
    28. Myotis lucifugus miRNA
    29. Nannospalax galili miRNA
    30. Neotoma lepida let-7 microRNA precursor
    31. Nomascus leucogenys let-7 microRNA precursor
    32. Pan troglodytes let-7 microRNA precursor
    33. Papio anubis let-7 microRNA precursor
    34. Pongo abelii microRNA let-7g
    35. Pteropus alecto let-7 microRNA precursor
    36. Pteropus vampyrus miRNA
    37. Rattus norvegicus let-7g stem-loop (rno-let-7g)
    38. Sarcophilus harrisii let-7 microRNA precursor
    39. Sorex araneus miRNA
    40. Sus scrofa let-7 microRNA precursor
    41. Tupaia belangeri miRNA
    42. Tupaia chinensis let-7 microRNA precursor
    43. Tursiops truncatus (bottlenosed dolphin) miRNA
    44. Vicugna pacos (alpaca) miRNA
    2D structure New