Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Tursiops truncatus (bottlenosed dolphin) miRNA (ENSTTRG00000022754.1, ENSTTRG00000023380.1) secondary structure diagram

Tursiops truncatus (bottlenosed dolphin) miRNA (ENSTTRG00000022754.1, ENSTTRG00000023380.1) URS00000B0351_9739

Automated summary: This pre miRNA sequence is 88 nucleotides long and is found in Tursiops truncatus. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (let-7, RF00027). Tursiops truncatus (bottlenosed dolphin) miRNA (ENSTTRG00000022754.1, ENSTTRG00000023380.1) sequence is a product of ENSTTRG00000022754.1, ENSTTRG00000023380.1 genes. Found in the bottlenosed dolphin reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCAGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUAACUGUACAGGCCACUGCCUUGCCAGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 65 other species

    1. Ailuropoda melanoleuca let-7 microRNA precursor
    2. Callithrix jacchus let-7 microRNA precursor
    3. Camelus ferus let-7 microRNA precursor
    4. Canis lupus familiaris let-7 microRNA precursor
    5. Cricetulus griseus miRNA (ENSCGRG00000021599.1, ENSCGRG00001003788.1)
    6. Dasypus novemcinctus (nine-banded armadillo) miRNA (ENSDNOG00000029126.1)
    7. Equus caballus let-7g stem-loop (eca-let-7g)
    8. Erinaceus europaeus miRNA (ENSEEUG00000016063.1)
    9. Felis catus let-7 microRNA precursor
    10. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000003569.1)
    11. Gorilla gorilla gorilla let-7 microRNA precursor
    12. Heterocephalus glaber (naked mole-rat) miRNA (ENSHGLG00000022476.1, ENSHGLG00100024052.1)
    13. Homo sapiens let-7 microRNA precursor
    14. Jaculus jaculus miRNA (ENSJJAG00000006467.1)
    15. Loxodonta africana microRNA let-7g (ENSLAFG00000025050.1)
    16. Macaca fascicularis let-7 microRNA precursor
    17. Macaca mulatta let-7 microRNA precursor
    18. Mesocricetus auratus miRNA (ENSMAUG00000002534.1)
    19. Microtus ochrogaster (vole) microRNA let7g (ENSMOCG00000005291.1)
    20. Monodelphis domestica let-7 microRNA precursor
    21. Mus caroli microRNA let7g (MGP_CAROLIEiJ_G0008292.1)
    22. Mus musculus let-7g stem-loop (mmu-let-7g)
    23. Mus pahari (Shrew mouse) microRNA let7g (MGP_PahariEiJ_G0006694.1)
    24. Mus spretus microRNA let7g (MGP_SPRETEiJ_G0008731.1)
    25. Mustela putorius furo let-7 microRNA precursor
    26. Myotis brandtii let-7 microRNA precursor
    27. Myotis davidii let-7 microRNA precursor
    28. Myotis lucifugus miRNA (ENSMLUG00000017897.1)
    29. Nannospalax galili miRNA (ENSNGAG00000006935.1)
    30. Neotoma lepida let-7 microRNA precursor
    31. Nomascus leucogenys let-7 microRNA precursor
    32. Oryctolagus cuniculus let-7 microRNA precursor
    33. Pan troglodytes let-7 microRNA precursor
    34. Papio anubis let-7 microRNA precursor
    35. Pongo abelii microRNA let-7g (ENSPPYG00000021497.1)
    36. Pteropus alecto let-7 microRNA precursor
    37. Pteropus vampyrus miRNA (ENSPVAG00000024777.1)
    38. Rattus norvegicus let-7g stem-loop (rno-let-7g)
    39. Sarcophilus harrisii let-7 microRNA precursor
    40. Sorex araneus miRNA (ENSSARG00000015735.1)
    41. Sus scrofa let-7 microRNA precursor
    42. Tupaia belangeri (northern tree shrew) miRNA (ENSTBEG00000017987.1)
    43. Tupaia chinensis let-7 microRNA precursor
    44. Vicugna pacos miRNA (ENSVPAG00000015975.1)
    2D structure New