Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Erinaceus europaeus (western European hedgehog) miRNA (ENSEEUG00000016063.1) secondary structure diagram

Erinaceus europaeus (western European hedgehog) miRNA (ENSEEUG00000016063.1) URS00000B0351_9365

Automated summary: This pre miRNA sequence is 88 nucleotides long and is found in Erinaceus europaeus. Annotated by 2 databases (Ensembl, Rfam). Described in 4 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (let-7, RF00027). Erinaceus europaeus (western European hedgehog) miRNA (ENSEEUG00000016063.1) sequence is a product of 7 microRNA precurso, 7 microRNA precursor, ENSEEUG00000016063.1, let-7 microRNA precursor genes. Found in the western european hedgehog reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCAGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUAACUGUACAGGCCACUGCCUUGCCAGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 65 other species

    1. Ailuropoda melanoleuca let-7 microRNA precursor
    2. Callithrix jacchus let-7 microRNA precursor
    3. Camelus ferus let-7 microRNA precursor
    4. Canis lupus familiaris let-7 microRNA precursor
    5. Cricetulus griseus miRNA (ENSCGRG00000021599.1, ENSCGRG00001003788.1)
    6. Dasypus novemcinctus (nine-banded armadillo) miRNA (ENSDNOG00000029126.1)
    7. Equus caballus let-7g stem-loop (eca-let-7g)
    8. Felis catus let-7 microRNA precursor
    9. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000003569.1)
    10. Gorilla gorilla gorilla let-7 microRNA precursor
    11. Heterocephalus glaber (naked mole-rat) miRNA (ENSHGLG00000022476.1, ENSHGLG00100024052.1)
    12. Homo sapiens let-7 microRNA precursor
    13. Jaculus jaculus miRNA (ENSJJAG00000006467.1)
    14. Loxodonta africana microRNA let-7g (ENSLAFG00000025050.1)
    15. Macaca fascicularis let-7 microRNA precursor
    16. Macaca mulatta let-7 microRNA precursor
    17. Mesocricetus auratus miRNA (ENSMAUG00000002534.1)
    18. Microtus ochrogaster (vole) microRNA let7g (ENSMOCG00000005291.1)
    19. Monodelphis domestica let-7 microRNA precursor
    20. Mus caroli microRNA let7g (MGP_CAROLIEiJ_G0008292.1)
    21. Mus musculus let-7g stem-loop (mmu-let-7g)
    22. Mus pahari (Shrew mouse) microRNA let7g (MGP_PahariEiJ_G0006694.1)
    23. Mus spretus microRNA let7g (MGP_SPRETEiJ_G0008731.1)
    24. Mustela putorius furo let-7 microRNA precursor
    25. Myotis brandtii let-7 microRNA precursor
    26. Myotis davidii let-7 microRNA precursor
    27. Myotis lucifugus miRNA (ENSMLUG00000017897.1)
    28. Nannospalax galili miRNA (ENSNGAG00000006935.1)
    29. Neotoma lepida let-7 microRNA precursor
    30. Nomascus leucogenys let-7 microRNA precursor
    31. Oryctolagus cuniculus let-7 microRNA precursor
    32. Pan troglodytes let-7 microRNA precursor
    33. Papio anubis let-7 microRNA precursor
    34. Pongo abelii microRNA let-7g (ENSPPYG00000021497.1)
    35. Pteropus alecto let-7 microRNA precursor
    36. Pteropus vampyrus miRNA (ENSPVAG00000024777.1)
    37. Rattus norvegicus let-7g stem-loop (rno-let-7g)
    38. Sarcophilus harrisii let-7 microRNA precursor
    39. Sorex araneus miRNA (ENSSARG00000015735.1)
    40. Sus scrofa let-7 microRNA precursor
    41. Tupaia belangeri (northern tree shrew) miRNA (ENSTBEG00000017987.1)
    42. Tupaia chinensis let-7 microRNA precursor
    43. Tursiops truncatus miRNA (ENSTTRG00000022754.1, ENSTTRG00000023380.1)
    44. Vicugna pacos miRNA (ENSVPAG00000015975.1)
    2D structure New