Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-548n URS00000AD02D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-548n: Hsa-mir-548n is a microRNA that has been identified as a candidate ID-miR for MCF7 cells and is significantly overrepresented in the targets of miRNA in MCF7 cells [PMC4401570]. Although hsa-mir-548n has been found to regulate many target genes, it has not been previously reported in sudden sensorineural hearing loss (SSNHL) [PMC5708990]. However, it is suggested that hsa-mir-548n, along with other miRNAs such as hsa-miR-34a, hsa-miR-15a, and hsa-miR-143, may have a role in the pathogenesis of SSNHL based on the role of their target genes in the disease [PMC5708990]. Hsa-mir-548n has also been found to be upregulated in patients with lymph node metastasis (LNM) in endometrial endometrioid carcinoma (EEC) [PMC8082502]. In breast cancer cells, dysregulated expression of hsa-mir-548n may be associated with the upregulation of lncRNA LINC01087 and may inhibit normal cell functioning by promoting proliferation [PMC6965516]. Hsa-mir-548n has also been associated with apoptotic pathways and tumor-suppression activity [PMC6965516]. In addition to hsa-mir-548n, another microRNA called hsa-miR-548ap-5p has also fulfilled stringent criteria for its potential role as a biomarker or therapeutic target [PMC4856985].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAAGUAAUUGUGGAUUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Callithrix jacchus cja-miR-548c
  2. Pan troglodytes (chimpanzee) ptr-miR-548n
Publications