Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) cja-miR-455 URS00000AD002_9483

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUGUGCCUUUGGACUACAUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus Bta-Mir-455_5p (mature (guide))
  2. Canis lupus familiaris cfa-miR-455
  3. Capra hircus (goat) chi-miR-455-5p
  4. Cavia porcellus (domestic guinea pig) cpo-miR-455-5p
  5. Cervus elaphus cel-miR-455
  6. Cricetulus griseus cgr-miR-455-5p
  7. Dasypus novemcinctus dno-miR-455-5p
  8. Echinops telfairi Ete-Mir-455_5p (mature (guide))
  9. Homo sapiens (human) hsa-miR-455-5p
  10. Macaca mulatta mml-miR-455-5p
  11. Mus musculus mmu-miR-455-5p
  12. Nomascus leucogenys nle-miR-455
  13. Oryctolagus cuniculus ocu-miR-455-5p
  14. Pongo pygmaeus ppy-miR-455-5p
  15. Rattus norvegicus (Norway rat) rno-miR-455-5p
  16. Sus scrofa ssc-miR-455-5p