Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-455-5p URS00000AD002_10090

Automated summary: This piRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 5 databases (RefSeq, ENA, PirBase, MirGeneDB, miRBase). Described in 29 papers. Mus musculus (house mouse) mmu-miR-455-5p sequence is a product of mmu-miR-455-5p, Mir455, mmu-miR-455, miR-455, miR-455-5p genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAUGUGCCUUUGGACUACAUCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 27 other species

    1. Bos taurus (cattle) Bta-Mir-455_5p (mature (guide))
    2. Callithrix jacchus cja-miR-455
    3. Canis lupus familiaris cfa-miR-455
    4. Capra hircus chi-miR-455-5p
    5. Cavia porcellus (domestic guinea pig) cpo-miR-455-5p
    6. Cervus elaphus (red deer) cel-miR-455
    7. Cricetulus griseus cgr-miR-455-5p
    8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-455-5p
    9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-455_5p (mature (guide))
    10. Homo sapiens hsa-miR-455-5p
    11. Macaca mulatta mml-miR-455-5p
    12. Nomascus leucogenys nle-miR-455
    13. Oryctolagus cuniculus (rabbit) ocu-miR-455-5p
    14. Pongo pygmaeus ppy-miR-455-5p
    15. Rattus norvegicus rno-miR-455-5p
    16. Sus scrofa ssc-miR-455-5p