Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-455-5p URS00000AD002_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-455: Mmu-mir-455 is a microRNA that has been found to be elevated in so-stimulated CM EXOs and is involved in preventing the activation of matrix metalloproteinase 9 (MMP9), which helps preserve the heart from fibrosis and myocyte uncoupling [PMC6406975]. In a study involving mice, different groups were injected with mmu-mir-455 agomir, mmu-miR-210 agomir, or control agomir, and it was found that the mmu-mir-455 agomir group had higher cartilage OARSI grade scores and collagen II content compared to the control group [PMC7658376]. Mmu-mir-455 has been identified as a precursor miRNA [PMC4356433]. In another study, it was found that mmu-miR-29c at ST and LT did not show identical regulation as observed with microarray profiling, but mmu-mir-455 at LT and mmu-miR-450a at IT did show similar regulation [PMC3030602]. Mmu-mir-455 has been selected based on its high and significant differential expression in a lung pathology model [PMC3030602]. The expression of mmu-mir-455 was first documented in miRBase v8.1 [PMC3125744]. TaqMan RT-PCR assays were used to assess the expression of mmu-mir-455 in mice [PMC4386824]. The miRNA–messenger RNA regulatory networks revealed common target genes between mmu-miR-181d and mmu-mir-455 (MOSPD1), between mmu-miR31 and mmu miR182 (TAF4A), between between between between between between (RTN4), between (BDNF), between between between (PPP1R10), and between (LRRC1) [PMC3742134].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUGUGCCUUUGGACUACAUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus Bta-Mir-455_5p (mature (guide))
  2. Callithrix jacchus cja-miR-455
  3. Canis lupus familiaris cfa-miR-455
  4. Capra hircus (goat) chi-miR-455-5p
  5. Cavia porcellus (domestic guinea pig) cpo-miR-455-5p
  6. Cervus elaphus cel-miR-455
  7. Cricetulus griseus cgr-miR-455-5p
  8. Dasypus novemcinctus dno-miR-455-5p
  9. Echinops telfairi Ete-Mir-455_5p (mature (guide))
  10. Homo sapiens (human) hsa-miR-455-5p
  11. Macaca mulatta mml-miR-455-5p
  12. Nomascus leucogenys nle-miR-455
  13. Oryctolagus cuniculus ocu-miR-455-5p
  14. Pongo pygmaeus ppy-miR-455-5p
  15. Rattus norvegicus (Norway rat) rno-miR-455-5p
  16. Sus scrofa ssc-miR-455-5p
Publications