Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sarcophilus harrisii (Tasmanian devil) sha-let-7i URS00000ABDA6_9305

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Sarcophilus harrisii. Annotated by 2 databases (RefSeq, miRBase). Sarcophilus harrisii (Tasmanian devil) sha-let-7i sequence is a product of sha-let-7i, let-7, MIRLET7I, let-7i genes. Found in the tasmanian devil reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAGGUAGUAGUUUGUGCUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 10 other species

    1. Alligator mississippiensis ami-let-7i-5p
    2. Capra hircus (goat) let-7i
    3. Cyprinus carpio (common carp) ccr-let-7i
    4. Gallus gallus gga-let-7i
    5. Gorilla gorilla (western gorilla) ggo-let-7i
    6. Monodelphis domestica (gray short-tailed opossum) mdo-let-7i-5p
    7. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72640
    8. Ovis aries miscellaneous RNA
    9. Xenopus laevis xla-let-7i-5p
    10. Xenopus tropicalis (tropical clawed frog) xtr-let-7i
    Publications New