Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-let-7i URS00000ABDA6_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-let-7i: Gga-let-7i is a downregulated miRNA that is associated with loss of tumor suppressive functions [PMC5065965]. It is involved in multiple signaling pathways, including MAPK, TGF-beta, Notch, Wnt, mTOR, Cell cycle, P53, and Jak-STAT [PMC9201442]. Through bioinformatic analysis and prediction analysis of the correlation between circRNA and miRNA, it was found that gga-let-7i can be targeted by multiple circRNAs [PMC9201442]. The expression of gga-let-7i has been detected in various studies [PMC3406056]. It has been reported that gga-let-7i is associated with tumorigenesis and the aberrant expression of the retrovirus ALV-J [PMC5276853]. In summary, gga-let-7i is a downregulated miRNA that plays a role in tumor suppression. It is involved in multiple signaling pathways and can be targeted by circRNAs. The expression of gga-let-7i has been detected in various studies. Furthermore, it has been reported to be associated with tumorigenesis and the aberrant expression of ALV-J retrovirus.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAGUUUGUGCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Alligator mississippiensis ami-let-7i-5p
  2. Capra hircus (goat) let-7i
  3. Cyprinus carpio (common carp) ccr-let-7i
  4. Gorilla gorilla gorilla ggo-let-7i (MIRLET7I)
  5. Gorilla gorilla ggo-let-7i
  6. Monodelphis domestica mdo-let-7i-5p
  7. Mus musculus Mus_musculus piRNA piR-mmu-72640
  8. Ovis aries miscellaneous RNA
  9. Sarcophilus harrisii sha-let-7i
  10. Xenopus laevis (African clawed frog) xla-let-7i-5p
  11. Xenopus tropicalis (tropical clawed frog) xtr-let-7i
Publications