Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-326 URS00000A939F_9600

Automated summary: This miRNA sequence is 20 nucleotides long and is found in Pongo pygmaeus. Annotated by 1 database (miRBase). Described in 0 papers.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCUCUGGGCCCUUCCUCCAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Bos taurus (cattle) bta-miR-326
    2. Canis lupus familiaris cfa-miR-326
    3. Cavia porcellus (domestic guinea pig) cpo-miR-326-3p
    4. Dasypus novemcinctus dno-miR-326-3p
    5. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-326_3p (mature (guide))
    6. Gorilla gorilla ggo-miR-326
    7. Homo sapiens hsa-miR-326
    8. Macaca fascicularis (crab-eating macaque) microRNA miR-326-3p
    9. Macaca mulatta Mml-Mir-326_3p (mature (guide))
    10. Mus musculus Mmu-Mir-326_3p (mature (guide))
    11. Oryctolagus cuniculus ocu-miR-326-3p
    12. Pan troglodytes ptr-miR-326
    13. Rattus norvegicus (Norway rat) Rno-Mir-326_3p (mature (guide))
    14. Sus scrofa (pig) ssc-miR-326