Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-326-3p URS00000A939F_9361

Automated summary: This miRNA sequence is 20 nucleotides long and is found in Dasypus novemcinctus. Annotated by 2 databases (miRBase, MirGeneDB). Described in 1 paper. Found in the nine-banded armadillo reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCUCUGGGCCCUUCCUCCAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 22 other species

    1. Bos taurus (cattle) bta-miR-326
    2. Canis lupus familiaris cfa-miR-326
    3. Cavia porcellus (domestic guinea pig) cpo-miR-326-3p
    4. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-326_3p (mature (guide))
    5. Gorilla gorilla (western gorilla) ggo-miR-326
    6. Homo sapiens hsa-miR-326
    7. Macaca fascicularis microRNA miR-326-3p
    8. Macaca mulatta Mml-Mir-326_3p (mature (guide))
    9. Mus musculus (house mouse) Mmu-Mir-326_3p (mature (guide))
    10. Oryctolagus cuniculus (rabbit) ocu-miR-326-3p
    11. Pan troglodytes (chimpanzee) ptr-miR-326
    12. Pongo pygmaeus ppy-miR-326
    13. Rattus norvegicus Rno-Mir-326_3p (mature (guide))
    14. Sus scrofa ssc-miR-326