Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
5S ribosomal RNA from Haloarcula marismortui ATCC 43049 (PDB 4V9F, chain 9) secondary structure diagram

5S ribosomal RNA from Haloarcula marismortui ATCC 43049 (PDB 4V9F, chain 9) URS00000A7E81_272569

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAGGCGGCCACAGCGGUGGGGUUGCCUCCCGUACCCAUCCCGAACACGGAAGAUAAGCCCACCAGCGUUCCAGGGAGUACUGGAGUGCGCGAGCCUCUGGGAAAUCCGGUUCGCCGCCACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Methanothermobacter thermautotrophicus str. Delta H 5S ribosomal RNA from Methanothermobacter thermautotrophicus str. Delta H (PDB 4ADX, chain 9)
  2. Haloarcula marismortui 5S rRNA
2D structure Publications