Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-let-7d-5p URS00000A07C1_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 8 databases (RefSeq, MirGeneDB, TarBase, ENA, LncBase, miRBase, IntAct, PirBase). Described in 27 papers. Mus musculus (house mouse) mmu-let-7d-5p sequence is a product of mmu-let-7d, let-7, let-7d-5p, mmu-let-7d-5p, let-7d, Mirlet7d genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including (homologous Alu RNA binding protein), 0610010I20Rik, 0610013D04Rik, 0610013E23Rik, 0610025H04Rik, 0610030E20Rik, 0610030G24Rik, 0610037K01Rik, 0610039N19Rik, 0910001A06Rik.

Interactions 5

According to IntAct, Mus musculus (house mouse) mmu-let-7d-5p interacts with:

Interaction id Participant Synonyms
EBI-11515735 P56960 Autoantigen PM/Scl 2 homolog B1ARY9 EBI-8316161 Exosc10 MINT-4094804 P56960 Pmscl2 Polymyositis/scleroderma autoantigen 2 homolog Q9QYS8 Q9R0B1 exosx_mouse
EBI-11515770 P56960 Autoantigen PM/Scl 2 homolog B1ARY9 EBI-8316161 Exosc10 MINT-4094804 P56960 Pmscl2 Polymyositis/scleroderma autoantigen 2 homolog Q9QYS8 Q9R0B1 exosx_mouse
EBI-11515723 Q8VIJ6 A2A7U6 DNA-binding p52/p100 complex, 100 kDa subunit EBI-6094576 Polypyrimidine tract-binding protein-associated-splicing factor Psf Q8VIJ6 Q9ERW2 Sfpq sfpq_mouse
EBI-11515764 Q9CRA8 D7Wsu180e EBI-644704 Exosc5 Exosome component 5 Q8K1J2 Q9CRA8 Ribosomal RNA-processing protein 46 Rrp46 exos5_mouse
EBI-11515756 Q9DAA6 Csl4 EBI-11149613 Exosc1 Exosome component 1 Q9DAA6 Q9DCB9 exos1_mouse

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGAGGUAGUAGGUUGCAUAGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 46 other species

    1. Alligator mississippiensis Ami-Let-7-P2c1_5p (mature (guide))
    2. Anolis carolinensis Aca-Let-7-P2c1_5p (mature (guide))
    3. Bos taurus (cattle) bta-let-7d
    4. Callithrix jacchus cja-let-7d
    5. Callorhinchus milii (elephant shark) eshark_let-7_7
    6. Canis lupus familiaris Cfa-Let-7-P2c1_5p (mature (guide))
    7. Capra hircus chi-let-7d-5p
    8. Cavia porcellus (domestic guinea pig) cpo-let-7d-5p
    9. Cervus elaphus (red deer) cel-let-7d
    10. Chiloscyllium plagiosum microRNA cpl-let-7d-5p
    11. Chrysemys picta bellii Cpi-Let-7-P2c1_5p (mature (guide))
    12. Chrysemys picta (Painted turtle) cpi-let-7d-5p
    13. Columba livia (rock pigeon) cli-let-7d-5p
    14. Cricetulus griseus cgr-let-7d-5p
    15. Dasypus novemcinctus (nine-banded armadillo) dno-let-7d-5p
    16. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P2c1_5p (mature (guide))
    17. Equus caballus (horse) eca-let-7d
    18. Homo sapiens hsa-let-7d-5p
    19. Macaca mulatta mml-let-7d
    20. Monodelphis domestica Mdo-Let-7-P2c1_5p (mature (guide))
    21. Ophiophagus hannah oha-let-7d-5p
    22. Ornithorhynchus anatinus oan-let-7d-5p
    23. Oryctolagus cuniculus (rabbit) ocu-let-7d-5p
    24. Pan troglodytes (chimpanzee) ptr-let-7d
    25. Pongo pygmaeus ppy-let-7d
    26. Python bivittatus pbv-let-7d-5p
    27. Rattus norvegicus rno-let-7d-5p
    28. Sarcophilus harrisii Sha-Let-7-P2c1_5p (mature (guide))
    29. Scyliorhinus torazame (cloudy catshark) Sto-Let-7-P2c1_5p (mature (guide))
    30. Sus scrofa ssc-let-7d-5p
    31. Taeniopygia guttata (zebra finch) tgu-let-7d-5p