v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Takifugu rubripes (torafugu) fru-miR-18 URS00000A05D9_31033

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAAGGUGCAUCUAGUGCAGAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 67 other species

  1. Ateles geoffroyi age-miR-18
  2. Bos taurus (cattle) bta-miR-18a
  3. Canis lupus familiaris (dog) cfa-miR-18a
  4. Columba livia (rock pigeon) cli-miR-18a-5p
  5. Danio rerio dre-miR-18a
  6. Gadus morhua (Atlantic cod) gmo-miR-18a-5p
  7. Gallus gallus gga-miR-18a-5p
  8. Gorilla gorilla gorilla ggo-miR-18a (MIR18A)
  9. Gorilla gorilla (western gorilla) ggo-miR-18a
  10. Haplochromis burtoni abu-miR-18a
  11. Homo sapiens (human) miscellaneous RNA
  12. Lagothrix lagotricha lla-miR-18
  13. Lemur catta lca-miR-18
  14. Macaca mulatta (Rhesus monkey) mml-miR-18a-5p
  15. Macaca nemestrina (pig-tailed macaque) mne-miR-18
  16. Maylandia zebra mze-miR-18a
  17. Monodelphis domestica mdo-miR-18a-5p
  18. Mus musculus Mus_musculus piRNA piR-mmu-72635
  19. Neolamprologus brichardi nbr-miR-18a
  20. Oreochromis niloticus (Nile tilapia) oni-miR-18a
  21. Pan paniscus (pygmy chimpanzee) ppa-miR-18
  22. Pan troglodytes (chimpanzee) ptr-miR-18a
  23. Pongo pygmaeus ppy-miR-18a
  24. Pteropus alecto (black flying fox) pal-miR-18a-5p
  25. Pundamilia nyererei pny-miR-18a
  26. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63164
  27. Saguinus labiatus sla-miR-18
  28. Salmo salar (Atlantic salmon) ssa-miR-18b-5p
  29. Sus scrofa ssc-miR-18a
  30. Taeniopygia guttata tgu-miR-18a
  31. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-18
  32. Tor tambroides miR-18a
  33. Xenopus laevis (African clawed frog) xla-miR-18a
  34. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3307188
 Publications