Homo sapiens (human) BNC2 antisense RNA 1 (BNC2-AS1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) BNC2 antisense RNA 1 (BNC2-AS1) URS000009CB55_9606

428 nucleotides
9 databases (Ensembl, Ensembl/GENCODE, GeneCards, HGNC, LncBook, LNCipedia, MalaCards, NONCODE, RefSeq)
Found in 0 other species
7 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

BNC2-AS1: BNC2-AS1, a long non-coding RNA (lncRNA), has been implicated in gastric cancer (GC) progression, and its knockdown has been shown to suppress GC cell proliferation and migration [PMC7861632]. In a study investigating the risk and supportive lncRNAs in GC, BNC2-AS1 was identified as a high-risk lncRNA [PMC7244032]. BNC2-AS1 was found to overlap with other lncRNAs associated with GC, such as PARD6G-AS1, THUMPD3-AS1, LUCAT1, AC015813.1, LINC01504, and LINC01484 [PMC7900626]. Experimental evidence has demonstrated that knockdown of BNC2-AS1 inhibits the proliferation and migration of gastric cancer cells [PMC9076347]. Furthermore, BNC2-AS1 has been implicated in influencing the proliferation and invasion of gastric cancer [PMC8366027]. In the context of lung adenocarcinoma (LUAD), BNC2-AS1 expression was included in a predictive model for LUAD prognosis [PMC8366027]. Additionally, BNC2-AS1 was one of the lncRNAs included in a model for LUAD prognosis prediction [PMC8366027]. These findings highlight the potential role of BNC2-AS1 in gastric cancer progression and its association with lung adenocarcinoma prognosis [PMC8366027].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CUCACUUGAGCACAAUCCAAGAUGAAAGUUUCUGGGUUGUGUCCCCUUCGCUUCCUCUCACCCUCGCUCCCCCGCGGAGCCAAGGAGCCAGCAAUUGUGCAAGAGGAGACCGGCGCACAGGGCGCGUAUCACGGAGCGCAUGAGCCAGCAAGCCGAACGCCUCCAGCGCGGCCGGGACGGAGGAGCGGCUCUGGGGAAGACGCCGAGGCUGCGCCCGAGUCUGAACGAAGCUGCCUCCAGCCACAUGAAGUCAGUAGGGCUGUUCUGAGGGGCCCCGAGAUUUGAUGACUGUUUUUUAGGUUGCGGAACCUACUCCGAGAGAGCAAACACUUUGGACGAAGUGAUUCAUAUUGAUAGAUACAUUUGUUGGGAGGUGGCUUUUUUCAUUCUCAACAGAAAACAAAGAAAUAAAUUAAGUCUUCCCCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications