v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster (fruit fly) small nuclear RNA U6 at 96A a (Dmel_CR31379, Dmel_CR31539, Dmel_CR32867) secondary structure diagram

Drosophila melanogaster (fruit fly) small nuclear RNA U6 at 96A a (Dmel_CR31379, Dmel_CR31539, Dmel_CR32867) URS000009C54D_7227

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUUCUUGCUUCGGCAGAACAUAUACUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACGCAAAAUCGUGAAGCGUUCCACAUUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 51 other species

  1. Bactrocera dorsalis U6 spliceosomal RNA
  2. Bactrocera tryoni U6 spliceosomal RNA
  3. Belgica antarctica (Antarctic midge) U6 spliceosomal RNA
  4. Ceratitis capitata U6 spliceosomal RNA
  5. Clunio marinus U6 spliceosomal RNA
  6. Drosophila ananassae (Fruit fly) snRNA Dana\snRNA:U6:1
  7. Drosophila busckii U6 spliceosomal RNA
  8. Drosophila erecta (Fruit fly) snRNA Dere\snRNA:U6:2
  9. Drosophila ficusphila U6 spliceosomal RNA
  10. Drosophila grimshawi (Fruit fly) snRNA Dgri\snRNA:U6:1
  11. Drosophila guanche non-coding RNA
  12. Drosophila mojavensis snRNA Dmoj\snRNA:U6:1
  13. Drosophila persimilis (Fruit fly) snRNA Dper\snRNA:U6:1
  14. Drosophila pseudoobscura pseudoobscura snRNA Dpse\snRNA:U6:1
  15. Drosophila sechellia (Fruit fly) snRNA Dsec\snRNA:U6:1
  16. Drosophila simulans U6 spliceosomal RNA
  17. Drosophila virilis snRNA Dvir\snRNA:U6:1
  18. Drosophila willistoni (Fruit fly) snRNA Dwil\snRNA:U6:1
  19. Drosophila yakuba (Fruit fly) snRNA Dyak\snRNA:U6:1
  20. Hermetia illucens U6 spliceosomal RNA
  21. Lucilia cuprina U6 spliceosomal RNA
  22. Lutzomyia longipalpis U6 spliceosomal RNA
  23. Musca domestica U6 spliceosomal RNA
  24. Phlebotomus papatasi U6 spliceosomal RNA
  25. Rhagoletis pomonella (Apple magot fly) U6 spliceosomal RNA
  26. Stomoxys calcitrans (Stable fly) U6 spliceosomal RNA
 2D structure Publications