Automated summary: This miRNA sequence is 20 nucleotides long and is found in Mus musculus. Annotated by 5 databases (ENA, LncBase, miRBase, TarBase, RefSeq). Described in 7 papers. Mus musculus (house mouse) mmu-miR-669n sequence is a product of miR-669n, miR-669, Mir669n, mmu-miR-669n genes. Found in the house mouse reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610011D08Rik, 0610012F22Rik, 0610030G24Rik, 1010001C05Rik, 1110001M19Rik, 1110002G11Rik, 1110003E08Rik, 1110004P21Rik, 1110007A13Rik, 1110007A14Rik.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AUUUGUGUGUGGAUGUGUGU
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.