Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MELTF antisense RNA 1 (MELTF-AS1) URS000009863C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MELTF-AS1: MELTF-AS1 is a long non-coding RNA (lncRNA) that has been investigated for its potential role in cancer pathogenesis [PMC8213729]. However, a study examining the effect of knockdown MELTF-AS1 on the growth of osteosarcoma cells did not observe any significant impact [PMC8526484].

Targeting miRNAs 1 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUGUCCCACGCGCCGGGUCCCGUUGGCGCCGGGGCCUCCUGGGACGGCCUGGCCGCGGCCUGCGGGUAUGCGCUCUUUCCAGAAAGGCAGCACACGCAUGUCUCUGCCGUGGCCCCAGAUCCUCCCCGCGCCGCCGUUUUGAGCGUUCACACUCAUUACCCAGGUCCGUCUGGGAGACCCGCCGGGCUCCCGCCCUCCCGGCCCGCAGCCUCCUGGCCAAAAUCCUCCCGGGACACCCCACCUGGACUGCUGCGAACGGGCCUCCACCCGCCUCCCCGGACCCGCAGCGCCCCCCGCUCCCUCAGGGUUCUGGGGUGAAGGGGUCUGAAUAGCACCAGGGGAGGCGGCAGGGCGGGCCUGUCCUACCUGCGCCCGAGCACUGCUGAGACGACAUCCCUUCCAGCGCCGCCACGUAGUCCAGCCCCAGCCAGCCGCGGUCCUGGAAGCACCGCAGGCAGACGACCUGCUCCUCACUGGGCUCAGGCAGGGUCACCCGCCCAGUGCCGCUAGCUGCAAAUUGCUUUACAUACAGUGACCCAAAGAGCAAGUCAUUUCAGGGCCCCACCACUCUGAUUGGAAGUCAUAAGCUUGACAACUGAUUGGCCUCUGUCACCCAAGCGGGUGUGGGGACACUAGGCCCGCAGGUGCCACUGGAAGAGGCGUUCAGAAGCACUGCGGUGCUCCAGCUCCUGGAUGCAGAUAUCUCCCCACAAACCUAAACAAUUUCGAGAGGGACUUGUGUUCUGCAACCAGUCACAGAAUAUCAGGUGAGCUGGGCGUGUCUUCACUGACCCACCCGCCCAGGGAUGCUGCACUCCUCUCCACCCUGCUCAGAAUCACUAGAAUGACCGUUCUGUGGCUACAGCCCUAAAAGAGCUACUAAAAAGACCAGAAGUAGUAUGAGAACUUAUGAAUACGAAUAUAAAUAAAGGACAUCUGGAGAACAUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications