v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-30c-5p URS00000980C2_9986

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UGUAAACAUCCUACACUCUCAGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 90 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-30-P2b_5p (mature (guide))
    2. Anolis carolinensis (green anole) Aca-Mir-30-P2b_5p (mature (guide))
    3. Bos taurus Bta-Mir-30-P2d_5p (mature (guide))
    4. Callithrix jacchus cja-miR-30c
    5. Callorhinchus milii Cmi-Mir-30-P2b_5p (mature (guide))
    6. Canis lupus familiaris (dog) cfa-miR-30c
    7. Cavia porcellus cpo-miR-30c-5p
    8. Cervus elaphus (red deer) cel-miR-30c
    9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-30-P2b_5p (mature (guide))
    10. Chrysemys picta cpi-miR-30c-5p
    11. Columba livia cli-miR-30c-5p
    12. Danio rerio (zebrafish) Dre-Mir-30-P2b_5p (mature (guide))
    13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-30c-5p
    14. Drosophila erecta Drosophila_erecta piRNA piR-der-861406
    15. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-21349649
    16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-30-P2d_5p (mature (guide))
    17. Gadus morhua (Atlantic cod) gmo-miR-30b-5p
    18. Gallus gallus (chicken) gga-miR-30c-5p
    19. Gekko japonicus Gja-Mir-30-P2b_5p (mature (guide))
    20. Homo sapiens (human) Hsa-Mir-30-P2b_5p (mature (guide))
    21. Ictalurus punctatus (channel catfish) ipu-miR-30c
    22. Latimeria chalumnae Lch-Mir-30-P2b_5p (mature (guide))
    23. Lepisosteus oculatus Loc-Mir-30-P2b_5p (mature (guide))
    24. Macaca mulatta (Rhesus monkey) Mml-Mir-30-P2b_5p (mature (guide))
    25. Maylandia zebra (zebra mbuna) mze-miR-30b
    26. Microcaecilia unicolor Mun-Mir-30-P2b_5p (mature (guide))
    27. Monodelphis domestica Mdo-Mir-30-P2b_5p (mature (guide))
    28. Monopterus albus Mal-Mir-30-P2d_5p (mature (guide))
    29. Mus musculus Mmu-Mir-30-P2b_5p (mature (co-guide))
    30. Neolamprologus brichardi nbr-miR-30b
    31. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-30c
    32. Ophiophagus hannah (king cobra) oha-miR-30c-5p
    33. Oreochromis niloticus (Nile tilapia) oni-miR-30b
    34. Ornithorhynchus anatinus Oan-Mir-30-P2b_5p (mature (guide))
    35. Pteropus alecto (black flying fox) pal-miR-30c-5p
    36. Pundamilia nyererei pny-miR-30b
    37. Python bivittatus (Burmese python) pbv-miR-30c-5p
    38. Rattus norvegicus Rno-Mir-30-P2b_5p (mature (guide))
    39. Sarcophilus harrisii sha-miR-30c
    40. Scyliorhinus torazame Sto-Mir-30-P2d_5p (mature (guide))
    41. Sphenodon punctatus Spt-Mir-30-P2b_5p (mature (guide))
    42. Taeniopygia guttata (zebra finch) tgu-miR-30c-5p
    43. Tetraodon nigroviridis Tni-Mir-30-P2d_5p (mature (guide))
    44. Xenopus laevis (African clawed frog) Xla-Mir-30-P2b1_5p (mature (guide))
    45. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-30-P2b_5p (mature (guide))
     Publications