Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-30c-5p URS00000980C2_9986

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCUACACUCUCAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Alligator mississippiensis Ami-Mir-30-P2b_5p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-30-P2b_5p (mature (guide))
  3. Bos taurus Bta-Mir-30-P2d_5p (mature (guide))
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-30c
  5. Callorhinchus milii Cmi-Mir-30-P2b_5p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-30c
  7. Cavia porcellus cpo-miR-30c-5p
  8. Cervus elaphus cel-miR-30c
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-30-P2b_5p (mature (guide))
  10. Chrysemys picta cpi-miR-30c-5p
  11. Columba livia cli-miR-30c-5p
  12. Danio rerio Dre-Mir-30-P2b_5p (mature (guide))
  13. Dasypus novemcinctus dno-miR-30c-5p
  14. Drosophila erecta Drosophila_erecta piRNA piR-der-861406
  15. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-21349649
  16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-30-P2d_5p (mature (guide))
  17. Gadus morhua gmo-miR-30b-5p
  18. Gallus gallus gga-miR-30c-5p
  19. Gekko japonicus Gja-Mir-30-P2b_5p (mature (guide))
  20. Homo sapiens (human) Hsa-Mir-30-P2b_5p (mature (guide))
  21. Ictalurus punctatus (channel catfish) ipu-miR-30c
  22. Latimeria chalumnae Lch-Mir-30-P2b_5p (mature (guide))
  23. Lepisosteus oculatus Loc-Mir-30-P2b_5p (mature (guide))
  24. Macaca mulatta Mml-Mir-30-P2b_5p (mature (guide))
  25. Maylandia zebra mze-miR-30b
  26. Microcaecilia unicolor Mun-Mir-30-P2b_5p (mature (guide))
  27. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-30-P2b_5p (mature (guide))
  28. Monopterus albus (swamp eel) Mal-Mir-30-P2d_5p (mature (guide))
  29. Mus musculus Mmu-Mir-30-P2b_5p (mature (co-guide))
  30. Neolamprologus brichardi (lyretail cichlid) nbr-miR-30b
  31. Nomascus leucogenys nle-miR-30c
  32. Ophiophagus hannah (king cobra) oha-miR-30c-5p
  33. Oreochromis niloticus oni-miR-30b
  34. Ornithorhynchus anatinus (platypus) Oan-Mir-30-P2b_5p (mature (guide))
  35. Pteropus alecto pal-miR-30c-5p
  36. Pundamilia nyererei pny-miR-30b
  37. Python bivittatus pbv-miR-30c-5p
  38. Rattus norvegicus (Norway rat) Rno-Mir-30-P2b_5p (mature (guide))
  39. Sarcophilus harrisii sha-miR-30c
  40. Scyliorhinus torazame Sto-Mir-30-P2d_5p (mature (guide))
  41. Sphenodon punctatus (tuatara) Spt-Mir-30-P2b_5p (mature (guide))
  42. Taeniopygia guttata (zebra finch) tgu-miR-30c-5p
  43. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-30-P2d_5p (mature (guide))
  44. Xenopus laevis Xla-Mir-30-P2b1_5p (mature (guide))
  45. Xenopus tropicalis Xtr-Mir-30-P2b_5p (mature (guide))
Publications