Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-30c-5p URS00000980C2_9031

Automated summary: This miRNA sequence is 24 nucleotides long and is found in Gallus gallus. Annotated by 5 databases (RefSeq, miRBase, PirBase, ENA, MirGeneDB). Described in 8 papers. Gallus gallus (chicken) gga-miR-30c-5p sequence is a product of miR-30c, gga-miR-30c, miR-30c-5p, gga-miR-30c-5p, miR-30, MIR30C1, MIR30C2 genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUAAACAUCCUACACUCUCAGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 36 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-30-P2b_5p (mature (guide))
    2. Anolis carolinensis (green anole) Aca-Mir-30-P2b_5p (mature (guide))
    3. Bos taurus (cattle) Bta-Mir-30-P2b_5p (mature (guide))
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-30c
    5. Canis lupus familiaris cfa-miR-30c
    6. Cavia porcellus (domestic guinea pig) cpo-miR-30c-5p
    7. Cervus elaphus cel-miR-30c
    8. Chrysemys picta bellii Cpi-Mir-30-P2b_5p (mature (guide))
    9. Chrysemys picta cpi-miR-30c-5p
    10. Columba livia cli-miR-30c-5p
    11. Danio rerio Dre-Mir-30-P2a_5p (mature (guide))
    12. Dasypus novemcinctus dno-miR-30c-5p
    13. Drosophila erecta Drosophila_erecta piRNA piR-der-861406
    14. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-21349649
    15. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-30-P2b_5p (mature (guide))
    16. Gadus morhua (Atlantic cod) gmo-miR-30b-5p
    17. Homo sapiens Hsa-Mir-30-P2b_5p (mature (guide))
    18. Ictalurus punctatus ipu-miR-30c
    19. Macaca mulatta Mml-Mir-30-P2b_5p (mature (guide))
    20. Maylandia zebra (zebra mbuna) mze-miR-30b
    21. Monodelphis domestica Mdo-Mir-30-P2b_5p (mature (guide))
    22. Mus musculus Mmu-Mir-30-P2b_5p (mature (guide))
    23. Neolamprologus brichardi nbr-miR-30b
    24. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-30c
    25. Ophiophagus hannah oha-miR-30c-5p
    26. Oreochromis niloticus oni-miR-30b
    27. Ornithorhynchus anatinus Oan-Mir-30-P2b_5p (mature (guide))
    28. Oryctolagus cuniculus ocu-miR-30c-5p
    29. Pteropus alecto (black flying fox) pal-miR-30c-5p
    30. Pundamilia nyererei pny-miR-30b
    31. Python bivittatus (Burmese python) pbv-miR-30c-5p
    32. Rattus norvegicus (Norway rat) Rno-Mir-30-P2b_5p (mature (guide))
    33. Sarcophilus harrisii (Tasmanian devil) sha-miR-30c
    34. Scyliorhinus torazame (cloudy catshark) Sto-Mir-30-P2b_5p (mature (guide))
    35. Taeniopygia guttata tgu-miR-30c-5p
    36. Xenopus laevis xla-miR-30c
    37. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-30-P2b_5p (mature (guide))