Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) ptr-miR-22 URS0000096022_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCUGCCAGUUGAAGAACUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 50 other species

  1. Alligator mississippiensis Ami-Mir-22-P1b_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-22-P1b_3p (mature (guide))
  3. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-22
  4. Ateles geoffroyi (black-handed spider monkey) age-miR-22
  5. Bos taurus Bta-Mir-22-P1b_3p (mature (guide))
  6. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-22
  7. Callorhinchus milii Cmi-Mir-22-P1b_3p (mature (guide))
  8. Canis lupus familiaris (dog) cfa-miR-22
  9. Cavia porcellus cpo-miR-22-3p
  10. Cervus elaphus cel-miR-22-3p
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-22-P1b_3p (mature (guide))
  12. Chrysemys picta cpi-miR-22-3p
  13. Columba livia cli-miR-22-3p
  14. Cricetulus griseus (Chinese hamster) cgr-miR-22-3p
  15. Dasypus novemcinctus dno-miR-22-3p
  16. Daubentonia madagascariensis (aye-aye) dma-miR-22
  17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-22-P1b_3p (mature (guide))
  18. Equus caballus (horse) eca-miR-22
  19. Gallus gallus gga-miR-22-3p
  20. Gekko japonicus Gja-Mir-22-P1b_3p (mature (guide))
  21. Homo sapiens (human) hsa-miR-22-3p
  22. Lagothrix lagotricha (brown woolly monkey) lla-miR-22
  23. Latimeria chalumnae Lch-Mir-22-P1b_3p (mature (guide))
  24. Lemur catta (Ring-tailed lemur) lca-miR-22
  25. Lepisosteus oculatus Loc-Mir-22-P1b_3p (mature (guide))
  26. Macaca mulatta mml-miR-22
  27. Macaca nemestrina (pig-tailed macaque) mne-miR-22
  28. Microcaecilia unicolor Mun-Mir-22-P1b_3p (mature (guide))
  29. Microcebus murinus (gray mouse lemur) mmr-miR-22
  30. Mus musculus mmu-miR-22-3p
  31. Nomascus leucogenys nle-miR-22
  32. Ophiophagus hannah (king cobra) oha-miR-22a
  33. Ornithorhynchus anatinus (platypus) oan-miR-22-3p
  34. Oryctolagus cuniculus (rabbit) ocu-miR-22-3p
  35. Otolemur garnettii (small-eared galago) oga-miR-22
  36. Pan paniscus (pygmy chimpanzee) ppa-miR-22
  37. Papio hamadryas pha-miR-22
  38. Pongo pygmaeus ppy-miR-22
  39. Pteropus alecto pal-miR-22-3p
  40. Python bivittatus pbv-miR-22-3p
  41. Rattus norvegicus (Norway rat) rno-miR-22-3p
  42. Saguinus labiatus (red-chested mustached tamarin) sla-miR-22
  43. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-22
  44. Scyliorhinus torazame Sto-Mir-22-P1b_3p (mature (guide))
  45. Sphenodon punctatus (tuatara) Spt-Mir-22-P1b_3p (mature (guide))
  46. Sus scrofa (pig) ssc-miR-22-3p
  47. Taeniopygia guttata (zebra finch) Tgu-Mir-22-P1b_3p (mature (guide))
  48. Tupaia chinensis tch-miR-22-3p
  49. Xenopus laevis Xla-Mir-22-P1b4_3p (mature (co-guide))
  50. Xenopus tropicalis xtr-miR-22-3p
Publications