Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gekko japonicus Gja-Mir-22-P1b_3p (mature (guide)) URS0000096022_146911

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Gekko japonicus. Annotated by 1 database (MirGeneDB).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AAGCUGCCAGUUGAAGAACUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 50 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-22-P1b_3p (mature (guide))
    2. Anolis carolinensis (green anole) Aca-Mir-22-P1b_3p (mature (guide))
    3. Artibeus jamaicensis aja-miR-22
    4. Ateles geoffroyi (black-handed spider monkey) age-miR-22
    5. Bos taurus (cattle) Bta-Mir-22-P1b_3p (mature (guide))
    6. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-22
    7. Callorhinchus milii (elephant shark) Cmi-Mir-22-P1b_3p (mature (guide))
    8. Canis lupus familiaris cfa-miR-22
    9. Cavia porcellus cpo-miR-22-3p
    10. Cervus elaphus cel-miR-22-3p
    11. Chrysemys picta bellii Cpi-Mir-22-P1b_3p (mature (guide))
    12. Chrysemys picta (Painted turtle) cpi-miR-22-3p
    13. Columba livia (rock pigeon) cli-miR-22-3p
    14. Cricetulus griseus cgr-miR-22-3p
    15. Dasypus novemcinctus dno-miR-22-3p
    16. Daubentonia madagascariensis dma-miR-22
    17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-22-P1b_3p (mature (guide))
    18. Equus caballus eca-miR-22
    19. Gallus gallus (chicken) gga-miR-22-3p
    20. Homo sapiens (human) hsa-miR-22-3p
    21. Lagothrix lagotricha lla-miR-22
    22. Latimeria chalumnae Lch-Mir-22-P1b_3p (mature (guide))
    23. Lemur catta lca-miR-22
    24. Lepisosteus oculatus Loc-Mir-22-P1b_3p (mature (guide))
    25. Macaca mulatta mml-miR-22
    26. Macaca nemestrina mne-miR-22
    27. Microcaecilia unicolor Mun-Mir-22-P1b_3p (mature (guide))
    28. Microcebus murinus (gray mouse lemur) mmr-miR-22
    29. Mus musculus mmu-miR-22-3p
    30. Nomascus leucogenys nle-miR-22
    31. Ophiophagus hannah (king cobra) oha-miR-22a
    32. Ornithorhynchus anatinus (platypus) oan-miR-22-3p
    33. Oryctolagus cuniculus ocu-miR-22-3p
    34. Otolemur garnettii (small-eared galago) oga-miR-22
    35. Pan paniscus (pygmy chimpanzee) ppa-miR-22
    36. Pan troglodytes (chimpanzee) ptr-miR-22
    37. Papio hamadryas pha-miR-22
    38. Pongo pygmaeus (Bornean orangutan) ppy-miR-22
    39. Pteropus alecto (black flying fox) pal-miR-22-3p
    40. Python bivittatus (Burmese python) pbv-miR-22-3p
    41. Rattus norvegicus (Norway rat) rno-miR-22-3p
    42. Saguinus labiatus sla-miR-22
    43. Saimiri boliviensis boliviensis sbo-miR-22
    44. Scyliorhinus torazame (cloudy catshark) Sto-Mir-22-P1b_3p (mature (guide))
    45. Sphenodon punctatus Spt-Mir-22-P1b_3p (mature (guide))
    46. Sus scrofa (pig) ssc-miR-22-3p
    47. Taeniopygia guttata (zebra finch) Tgu-Mir-22-P1b_3p (mature (guide))
    48. Tupaia chinensis tch-miR-22-3p
    49. Xenopus laevis Xla-Mir-22-P1b4_3p (mature (co-guide))
    50. Xenopus tropicalis (tropical clawed frog) xtr-miR-22-3p