Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-22-3p URS0000096022_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-22: rno-mir-22, a precursor DNA molecule, was synthesized by Genechem, Co., Ltd., in China [PMC5103773]. Plasmid vectors containing different forms of rno-mir-22 were obtained from GeneChem Technology Co., Ltd. [PMC6109564]. The Redd1 gene, which has a binding site for miR-22, was synthesized by GenePharma [PMC6405932]. The target mRNAs of rno-mir-22 were predicted using various databases, and Redd1 was found to directly associate with rno-mir-22 [PMC6405932]. In injured animals, rno-mir-22 and two other miRNAs were found to be down-regulated in the heart but upregulated in the kidney and lung [PMC6377737]. Primary cultures of cortical neurons and striatal neurons were infected with a lentiviral vector expressing rno-mir-22 at a specific concentration [PMC3547907]. The gene sequence for rno-mir-22 was cloned using specific primers [PMC3547907]. Lentiviral vectors encoding different genes, including the rat miR-22 gene (rno-mir-22), were produced using a four-plasmid system in HEK293T cells [PMC3547907].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCUGCCAGUUGAAGAACUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 50 other species

  1. Alligator mississippiensis Ami-Mir-22-P1b_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-22-P1b_3p (mature (guide))
  3. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-22
  4. Ateles geoffroyi (black-handed spider monkey) age-miR-22
  5. Bos taurus Bta-Mir-22-P1b_3p (mature (guide))
  6. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-22
  7. Callorhinchus milii Cmi-Mir-22-P1b_3p (mature (guide))
  8. Canis lupus familiaris (dog) cfa-miR-22
  9. Cavia porcellus cpo-miR-22-3p
  10. Cervus elaphus cel-miR-22-3p
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-22-P1b_3p (mature (guide))
  12. Chrysemys picta cpi-miR-22-3p
  13. Columba livia cli-miR-22-3p
  14. Cricetulus griseus (Chinese hamster) cgr-miR-22-3p
  15. Dasypus novemcinctus dno-miR-22-3p
  16. Daubentonia madagascariensis (aye-aye) dma-miR-22
  17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-22-P1b_3p (mature (guide))
  18. Equus caballus (horse) eca-miR-22
  19. Gallus gallus gga-miR-22-3p
  20. Gekko japonicus Gja-Mir-22-P1b_3p (mature (guide))
  21. Homo sapiens (human) hsa-miR-22-3p
  22. Lagothrix lagotricha (brown woolly monkey) lla-miR-22
  23. Latimeria chalumnae Lch-Mir-22-P1b_3p (mature (guide))
  24. Lemur catta (Ring-tailed lemur) lca-miR-22
  25. Lepisosteus oculatus Loc-Mir-22-P1b_3p (mature (guide))
  26. Macaca mulatta mml-miR-22
  27. Macaca nemestrina (pig-tailed macaque) mne-miR-22
  28. Microcaecilia unicolor Mun-Mir-22-P1b_3p (mature (guide))
  29. Microcebus murinus (gray mouse lemur) mmr-miR-22
  30. Mus musculus mmu-miR-22-3p
  31. Nomascus leucogenys nle-miR-22
  32. Ophiophagus hannah (king cobra) oha-miR-22a
  33. Ornithorhynchus anatinus (platypus) oan-miR-22-3p
  34. Oryctolagus cuniculus (rabbit) ocu-miR-22-3p
  35. Otolemur garnettii (small-eared galago) oga-miR-22
  36. Pan paniscus (pygmy chimpanzee) ppa-miR-22
  37. Pan troglodytes (chimpanzee) ptr-miR-22
  38. Papio hamadryas pha-miR-22
  39. Pongo pygmaeus ppy-miR-22
  40. Pteropus alecto pal-miR-22-3p
  41. Python bivittatus pbv-miR-22-3p
  42. Saguinus labiatus (red-chested mustached tamarin) sla-miR-22
  43. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-22
  44. Scyliorhinus torazame Sto-Mir-22-P1b_3p (mature (guide))
  45. Sphenodon punctatus (tuatara) Spt-Mir-22-P1b_3p (mature (guide))
  46. Sus scrofa (pig) ssc-miR-22-3p
  47. Taeniopygia guttata (zebra finch) Tgu-Mir-22-P1b_3p (mature (guide))
  48. Tupaia chinensis tch-miR-22-3p
  49. Xenopus laevis Xla-Mir-22-P1b4_3p (mature (co-guide))
  50. Xenopus tropicalis xtr-miR-22-3p
Publications