Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Eremothecium gossypii ATCC 10895 5.8S ribosomal RNA copy 23 (AGOS_RDN58_23) secondary structure diagram

Eremothecium gossypii ATCC 10895 5.8S ribosomal RNA copy 23 (AGOS_RDN58_23) URS0000095CDF_284811

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAACUUUCAACAACGGAUCUCUUGGUUCUCGCAUCGAUGAAGAACGCAGCGAAUUGCGAUAAGUAUUGUGAAUUGCAGAUUUUCGUGAAUCAUCGAAUCUUUGAACGCACAUUGCGUCCUCUGGUAUUCCAGGGGGCAUGCCUGUUUGAGCGUCAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Eremothecium gossypii 5.8S ribosomal RNA
  2. Eremothecium gossypii FDAG1 5.8S ribosomal RNA copy 20
2D structure