Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mycoplasmopsis bovis PG45 5S ribosomal RNA secondary structure diagram

Mycoplasmopsis bovis PG45 5S ribosomal RNA URS00000926CA_289397

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUAGUGGCCAUAGCAAAGGGGAUCACCUGAUACCAUUCCGAACUCAGUAGUUAAGCCCUUUAGCGCCGAAGAUACCAGAGAUGGGAAAAUAGGGAGCUGCUUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Mycoplasmopsis bovis 5S rRNA
  2. Mycoplasmopsis bovis CQ-W70 5S ribosomal RNA
  3. Mycoplasmopsis bovis Hubei-1 5S ribosomal RNA
  4. Mycoplasmopsis agalactiae 5S ribosomal RNA
2D structure