v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Ralstonia pickettii 12J 5S ribosomal RNA secondary structure diagram

Ralstonia pickettii 12J 5S ribosomal RNA URS0000090309_402626

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    CCUGGUGACCAUAGCGAGUCGGUACCACCCCUUCCCAUCCCGAACAGGACCGUGAAACGACUCCGCGCCGAUGAUAGUGCGGAUUCCCGUGUGAAAGUAGGUCAUCGCCAGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 72 other species

    1. Burkholderiaceae bacterium 26 5S ribosomal RNA
    2. Burkholderiales bacterium PBB6 5S ribosomal RNA
    3. Corchorus capsularis (jute) 5S ribosomal RNA
    4. Devosia psychrophila 5S ribosomal RNA
    5. Escherichia coli 5S ribosomal RNA
    6. Mumia flava 5S ribosomal RNA
    7. Mycobacteriaceae bacterium 1482268.1 5S ribosomal RNA
    8. Mycobacterium tuberculosis 5S ribosomal RNA
    9. Ralstonia insidiosa 5S ribosomal RNA
    10. Ralstonia mannitolilytica 5S ribosomal RNA
    11. Ralstonia pickettii 12D 5S ribosomal RNA
    12. Ralstonia pickettii 5S rRNA
    13. Ralstonia pickettii OR214 5S ribosomal RNA
    14. Ralstonia pseudosolanacearum 5S ribosomal RNA
    15. Ralstonia solanacearum 5S rRNA
    16. Ralstonia solanacearum FJAT-1458 5S ribosomal RNA
    17. Ralstonia solanacearum FJAT-91 5S ribosomal RNA
    18. Ralstonia pseudosolanacearum FQY_4 5S ribosomal RNA
    19. Ralstonia pseudosolanacearum GMI1000 5S ribosomal RNA
    20. Ralstonia solanacearum OE1-1 5S ribosomal RNA
    21. Ralstonia sp. 3N 5S ribosomal RNA
    22. Ralstonia sp. 5_2_56FAA 5S rRNA
    23. Ralstonia wenshanensis 5S ribosomal RNA
    24. Ralstonia sp. A12 5S ribosomal RNA
    25. Ralstonia sp. AU12-08 5S ribosomal RNA
    26. Ralstonia sp. MD27 5S ribosomal RNA
    27. Ralstonia sp. NFACC01 5S rRNA. Bacterial TSU
    28. Ralstonia sp. RS642 5S ribosomal RNA
    29. Ralstonia sp. RS647 5S ribosomal RNA
    30. Ralstonia sp. RS650 5S ribosomal RNA
    31. Ralstonia sp. 5S ribosomal RNA
    32. Ralstonia sp. TCR112 5S ribosomal RNA
    33. Ralstonia sp. UNCCL144 5S rRNA. Bacterial TSU
    34. Ralstonia syzygii 5S rRNA
    35. Salmonella enterica 5S ribosomal RNA
    36. Streptococcus pneumoniae 5S ribosomal RNA
    37. Burkholderiaceae bacterium None
    38. Ralstonia mojiangensis None
    39. Ralstonia soli None
    40. Ralstonia chuxiongensis None
    41. Ralstonia sp. GP73 None
    42. Ralstonia nicotianae None
    43. Ralstonia sp. 11b None
     2D structure Publications