Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Leishmania major 18S ribosomal (SSU) RNA URS00000900A9_347515

Automated summary: This rRNA sequence is 2,204 nucleotides long and is found in Leishmania major strain Friedlin. Annotated by 3 databases (ENA, SILVA, Ensembl Protists). Described in 4 papers. Matches 1 Rfam family (SSU_rRNA_eukarya, RF01960). Leishmania major 18S ribosomal (SSU) RNA sequence is a product of LMJF_27_rRNA_04, LMJF_27_rRNA_06, LMJF_27_rRNA_03, LMJF_27_rRNA_05, LMJF_27_rRNA_01, LMJF_27_rRNA_02 genes. Found in the Leishmania major strain Friedlin reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GAUCUGGUUGAUUCUGCCAGUAGUCAUAUGCUUGUUUCAAGGACUUAGCCAUGCAUGCCUCAGAAUCACUGCAUUUGCAGGAAUCUGCGCAUGGCUCAUUACAUCAGACGUAAUCUGCCGCAAAAAUCUUGCGGUUUCCGCAAAAUUGGAUAACUUGGCGAAACGCCAAGCUAAUACAUGAACCAACCGGGUGUUCUCCACUCCAGACGGUGGGCAACCAUCGUCGUGAGACGCCCAGCGAAUGAAUGACAGUAAAACCAAUGCCUUCACUGGCAGUAACACCCAGCAGUGUUGACUCAAUUCAUUCCGUGCGAAAGCCGGCUUGUUCCGGCGUCUUUUGACGAACAACUGCCCUAUCAGCUGGUGAUGGCCGUGUAGUGGACUGCCAUGGCGUUGACGGGAGCGGGGGAUUAGGGUUCGAUUCCGGAGAGGGAGCCUGAGAAAUAGCUACCACUUCUACGGAGGGCAGCAGGCGCGCAAAUUGCCCAAUGUCAAAACAAAACGAUGAGGCAGCGAAAAGAAAUAGAGUUGUCAGUCCAUUUGGAUUGUCAUUUCAAUGGGGGAUAUUUAAACCCAUCCAAUAUCGAGUAACAAUUGGAGGACAAGUCUGGUGCCAGCACCCGCGGUAAUUCCAGCUCCAAAAGCGUAUAUUAAUGCUGUUGCUGUUAAAGGGUUCGUAGUUGAACUGUGGGCUGUGCAGGUUUGUUCCUGGUCGUCCCGUCCAUGUCGGAUUUGGUGACCCAGGCCCUUGCAGCCCGUGAACAUUCAAAGAAACAAGAAACACGGGAGUGGUUCCUUUCCUGAUUUACGCAUGUCAUGCAUGCCAGGGGGCGUCCGUGAUUUUUUACUGUGACUAAAGAAGCGUGACUAAAGCAGUCAUUUGACUUGAAUUAGAAAGCAUGGGAUAACAAAGGAGCAGCCUCUAGGCUACCGUUUCGGCUUUUGUUGGUUUUAAAGGUCUAUUGGAGAUUAUGGAGCUGUGCGACAAGUGCUUUCCCAUCGCAACUUCGGUUCGGUGUGUGGCGCCUUUGAGGGGUUUAGUGCGUCCGGUGCGAGCUCCGGUUCGUCCGGCCGUAACGCCUUUUCAACUCACGGCCUCUAGGAAUGAAGGAGGGUAGUUCGGGGGAGAACGUACUGGGGCGUCAGAGGUGAAAUUCUUAGACCGCACCAAGACGAACUACAGCGAAGGCAUUCUUCAAGGAUACCUUCCUCAAUCAAGAACCAAAGUGUGGAGAUCGAAGAUGAUUAGAGACCAUUGUAGUCCACACUGCAAACGAUGACACCCAUGAAUUGGGGAUCUUAUGGGCCGGCCUGCGGCAGGGUUUACCCUGUGUCAGCACCGCGCCCGCUUUUACCAACUUACGUAUCUUUUCUAUUCGGCCUUUACCGGCCACCCACGGGAAUAUCCUCAGCACGUUUUCUGUUUUUUCACGCGAAAGCUUUGAGGUUACAGUCUCAGGGGGGAGUACGUUCGCAAGAGUGAAACUUAAAGAAAUUGACGGAAUGGCACCACAAGACGUGGAGCGUGCGGUUUAAUUUGACUCAACACGGGGAACUUUACCAGAUCCGGACAGGAUGAGGAUUGACAGAUUGAGUGUUCUUUCUCGAUUCCCUGAAUGGUGGUGCAUGGCCGCUUUUGGUCGGUGGAGUGAUUUGUUUGGUUGAUUCCGUCAACGGACGAGAUCCAAGCUGCCCAGUAGAAUUCAGAAUUGCCCAUAGAAUAGCAAACUCAUCGGCGGGUUUUACCCAACGGUGGGCCGCAUUCGGUCGAAUUCUUCUCUGCGGGAUUCCUUUGUAAUUGCACAAGGUGAAAUUUUGGGCAACAGCAGGUCUGUGAUGCUCCUCAAUGUUCUGGGCGACACGCGCACUACAAUGUCAGUGAGAACAAGAAAAACGACUUUUGUCGAACCUACUUGAUCAAAAGAGUGGGGAAACCCCGGAAUCACAUAGACCCACUUGGGACCGAGGAUUGCAAUUAUUGGUCGCGCAACGAGGAAUGUCUCGUAGGCGCAGCUCAUCAAACUGUGCCGAUUACGUCCCUGCCAUUUGUACACACCGCCCGUCGUUGUUUCCGAUGAUGGUGCAAUACAGGUGAUCGGACAGGCGGUGUUUUAUCCGCCCGAAAGUUCACCGAUAUUUCUUCAAUAGAGGAAGCAAAAGUCGUAACAAGGUAGCUGUAGGUGAACCUGCAGCUGGAUCAUUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.